Visualizing ribonuclease digestion of RNA-like polymers produced by hot wet-dry cycles.

Polymerization of nucleotides under prebiotic conditions simulating the early Earth has been extensively studied. Several independent methods have been used to verify that RNA-like polymers can be produced by hot wet-dry cycling of nucleotides. However, it has not been shown that these RNA-like polymers are similar to biological RNA with 3'-5' phosphodiester bonds. In the results described here, RNA-like polymers were generated from 5'-monophosphate nucleosides AMP and UMP. To confirm that the polymers resemble biological RNA, ribonuclease A should catalyze hydrolysis of the 3'-5' phosphodiester bonds between pyrimidine nucleotides to each other or to purine nucleotides, but not purine-purine nucleotide bonds. Here we show AFM images of specific polymers produced by hot wet-dry cycling of AMP, UMP and AMP/UMP (1:1) solutions on mica surfaces, before and after exposure to ribonuclease A. AMP polymers were unaffected by ribonuclease A but UMP polymers disappeared. This indicates that a major fraction of the bonds in the UMP polymers is indeed 3'-5' phosphodiester bonds. Some of the polymers generated from the AMP/UMP mixture also showed clear signs of cleavage. Because ribonuclease A recognizes the ester bonds in the polymers, we show for the first time that these prebiotically produced polymers are in fact similar to biological RNA but are likely to be linked by a mixture of 3'-5' and 2'-5' phosphodiester bonds.

Ribosome profiling reveals downregulation of UMP biosynthesis as the major early response to phage infection.

Bacteria have evolved diverse defense mechanisms to counter bacteriophage attacks. Genetic programs activated upon infection characterize phage-host molecular interactions and ultimately determine the outcome of the infection. In this study, we applied ribosome profiling to monitor protein synthesis during the early stages of sk1 bacteriophage infection in Lactococcus cremoris. Our analysis revealed major changes in gene expression within 5 minutes of sk1 infection. Notably, we observed a specific and severe downregulation of several pyr operons which encode enzymes required for uridine monophosphate biosynthesis. Consistent with previous findings, this is likely an attempt of the host to starve the phage of nucleotides it requires for propagation. We also observed a gene expression response that we expect to benefit the phage. This included the upregulation of 40 ribosome proteins that likely increased the host's translational capacity, concurrent with a downregulation of genes that promote translational fidelity (lepA and raiA). In addition to the characterization of host-phage gene expression responses, the obtained ribosome profiling data enabled us to identify two putative recoding events as well as dozens of loci currently annotated as pseudogenes that are actively translated. Furthermore, our study elucidated alterations in the dynamics of the translation process, as indicated by time-dependent changes in the metagene profile, suggesting global shifts in translation rates upon infection. Additionally, we observed consistent modifications in the ribosome profiles of individual genes, which were apparent as early as 2 minutes post-infection. The study emphasizes our ability to capture rapid alterations of gene expression during phage infection through ribosome profiling. IMPORTANCE: The ribosome profiling technology has provided invaluable insights for understanding cellular translation and eukaryotic viral infections. However, its potential for investigating host-phage interactions remains largely untapped. Here, we applied ribosome profiling to Lactococcus cremoris cultures infected with sk1, a major infectious agent in dairy fermentation processes. This revealed a profound downregulation of genes involved in pyrimidine nucleotide synthesis at an early stage of phage infection, suggesting an anti-phage program aimed at restricting nucleotide availability and, consequently, phage propagation. This is consistent with recent findings and contributes to our growing appreciation for the role of nucleotide limitation as an anti-viral strategy. In addition to capturing rapid alterations in gene expression levels, we identified translation occurring outside annotated regions, as well as signatures of non-standard translation mechanisms. The gene profiles revealed specific changes in ribosomal densities upon infection, reflecting alterations in the dynamics of the translation process.

Ribonucleotides differentially modulate oral glutamate detection thresholds.

The savory or umami taste of the amino acid glutamate is synergistically enhanced by the addition of the purines inosine 5'-monophosphate (IMP) and guanosine 5'-monophosphate (GMP) disodium salt. We hypothesized that the addition of purinergic ribonucleotides, along with the pyrimidine ribonucleotides, would decrease the absolute detection threshold of (increase sensitivity to) l-glutamic acid potassium salt (MPG). To test this, we measured both the absolute detection threshold of MPG alone and with a background level (3 mM) of 5 different 5'-ribonucleotides. The addition of the 3 purines IMP, GMP, and adenosine 5'-monophosphate (AMP) lowered the MPG threshold in all participants (P < 0.001), indicating they are positive modulators or enhancers of glutamate taste. The average detection threshold of MPG was 2.08 mM, and with the addition of IMP, the threshold was decreased by approximately 1.5 orders of magnitude to 0.046 mM. In contrast to the purines, the pyrimidines uridine 5'-monophosphate (UMP) and cytidine 5'-monophosphate (CMP) yielded different results. CMP reliably raised glutamate thresholds in 10 of 17 subjects, suggesting it is a negative modulator or diminisher of glutamate taste for them. The rank order of effects on increasing sensitivity to glutamate was IMP > GMP> AMP >> UMP// CMP. These data confirm that ribonucleotides are modulators of glutamate taste, with purines enhancing sensitivity and pyrimidines displaying variable and even negative modulatory effects. Our ability to detect the co-occurrence of glutamate and purines is meaningful as both are relatively high in evolutionarily important sources of nutrition, such as insects and fermented foods.

Structural and functional properties of uridine 5'-monophosphate synthase from Coffea arabica.

In higher eukaryotes and plants, the last two sequential steps in the de novo biosynthesis of uridine 5'-monophosphate (UMP) are catalyzed by a bifunctional natural chimeric protein called UMP synthase (UMPS). In higher plants, UMPS consists of two naturally fused enzymes: orotate phosphoribosyltransferase (OPRTase) at N-terminal and orotidine-5'-monophosphate decarboxylase (ODCase) at C-terminal. In this work, we obtained the full functional recombinant protein UMPS from Coffea arabica (CaUMPS) and studied its structure-function relationships. A biochemical and structural characterization of a plant UMPS with its two functional domains is described together with the presentation of the first crystal structure of a plant ODCase at 1.4 Å resolution. The kinetic parameters measured of CaOPRTase and CaODCase domains were comparable to those reported. The crystallographic structure revealed that CaODCase is a dimer that conserves the typical fold observed in other ODCases from prokaryote and eukaryote with a 1-deoxy-ribofuranose-5'-phosphate molecule bound in the active site of one subunit induced a closed conformation. Our results add to the knowledge of one of the key enzymes of the de novo biosynthesis of pyrimidines in plant metabolism and open the door to future applications.

Ledipasvir/Sofosbuvir in Hepatitis C Virus-Infected Children With Hematological Malignancies: A Pharmacokinetic Study.

PURPOSE: Children with hematological malignancies and chronic hepatitis C virus (HCV) infection are at a higher risk for rapid progression of liver disease and malignancy relapse due to multiple hepatitis flares and chemotherapy interruption. They are therefore potential candidates for microelimination of HCV infection. This study aimed to assess the effect of acute lymphoblastic leukemia (ALL) on the pharmacokinetic (PK) profile of direct-acting antivirals, namely ledipasvir/sofosbuvir (LDV/SOF) and the SOF major metabolite GS-331007. METHODS: This was a 24-week, prospective, controlled, open-label, 2-arm PK study of patients receiving 45/200 mg once-daily LDV/SOF orally for 12 weeks. Eligible patients were HCV-RNA-positive, treatment-naive children aged 6 to <12 years and/or weighing 17 to <35 kg with genotype 4 chronic HCV infection without cirrhosis. The primary efficacy and safety end points were the achievement of sustained virologic response for all patients with absence of any adverse events leading to permanent discontinuation of the study drug. Steady-state noncompartmental analysis was performed to determine the PK parameters of SOF, GS-331007, and LDV as the primary PK outcome. Dose suitability was based on the 90% CI of exposure geometric mean ratio percentage within 50% to 200% compared with adults. FINDINGS: Ten HCV-infected children with ALL (chemotherapy treatment group) and 12 eligible children with no malignancy (control group) were enrolled and completed the study period. All 22 patients achieved the sustained virologic response with no adverse events leading to interruption or permanent discontinuation of the study drug. Compared with the control group, the ALL group patients had similar SOF, GS-331007, and LDV exposure. Compared with adults, the AUCτ of GS-331007 was lower and the AUCτ and Cmax,ss of SOF and the Cmax,ss of LDV were modestly higher in the ALL group (acceptance limit, 50%-200%). However, the observed efficacy and favorable safety profile made these changes not clinically significant. IMPLICATIONS: Weight-based dosing of LDV/SOF (45/200 mg) is highly effective and safe among genotype 4 HCV-infected children weighing 17 to <35 kg and diagnosed with ALL undergoing maintenance chemotherapy. The similarity in the drug exposure, efficacy, and safety clinical end points between patients with and without hematological malignancy support their therapeutic equivalence. Further studies with a larger sample size may be required to confirm the safety of LDV/SOF in patients with ALL and to recommend appropriate dosing in children with hematological malignancies, if needed. CLINICALTRIALS: gov identifier: NCT03903185.

Functional analyses of Toxoplasma gondii dihydroorotase reveal a promising anti-parasitic target.

Toxoplasma gondii relies heavily on the de novo pyrimidine biosynthesis pathway for fueling the high uridine-5'-monophosphate (UMP) demand during parasite growth. The third step of de novo pyrimidine biosynthesis is catalyzed by dihydroorotase (DHO), a metalloenzyme that catalyzes the reversible condensation of carbamoyl aspartate to dihydroorotate. Here, functional analyses of TgDHO reveal that tachyzoites lacking DHO are impaired in overall growth due to decreased levels of UMP, and the noticeably growth restriction could be partially rescued after supplementation with uracil or high concentrations of L-dihydroorotate in vitro. When pyrimidine salvage pathway is disrupted, both DHOH35A and DHOD284E mutant strains proliferated much slower than DHO-expressing parasites, suggesting an essential role of both TgDHO His35 and Asp284 residues in parasite growth. Additionally, DHO deletion causes the limitation of bradyzoite growth under the condition of uracil supplementation or uracil deprivation. During the infection in mice, the DHO-deficient parasites are avirulent, despite the generation of smaller tissue cysts. The results reveal that TgDHO contributes to parasite growth both in vitro and in vivo. The significantly differences between TgDHO and mammalian DHO reflect that DHO can be exploited to produce specific inhibitors targeting apicomplexan parasites. Moreover, potential DHO inhibitors exert beneficial effects on enzymatic activity of TgDHO and T. gondii growth in vitro. In conclusion, these data highlight the important role of TgDHO in parasite growth and reveal that it is a promising anti-parasitic target for future control of toxoplasmosis.

Identification of compounds contributing to umami taste of pea protein isolate.

The umami taste of pea protein ingredients can be desirable or undesirable based on the food application. The compounds contributing to the umami perception of pea protein isolate (PPI) were investigated. Sensory-guided prep-liquid chromatography fractionation of a 10% aqueous PPI solution revealed one well-known compound, monosodium glutamate (MSG), however, it was reported at a subthreshold concentration. Two umami enhancing compounds 5'-adenosine monophosphate (AMP) and 5'-uridine monophosphate (UMP) were subsequently identified after the LC fractions were re-evaluated with MSG. Sensory recombination studies, utilizing the aqueous PPI solution as the base, confirmed AMP and UMP were umami enhancers of MSG and contributed approximately 81% of the perceived umami intensity. However UMP was only reported to enhance umami perception in combination with AMP (not individually) indicating synergistic interactions were observed between the two enhancer compounds. Therefore the presence of all three compounds are important for umami perception and provide an improved basis to tailor the flavor profile in PPI products.

Mobilization of a diatom mutator-like element (MULE) transposon inactivates the uridine monophosphate synthase (UMPS) locus in Phaeodactylum tricornutum.

Diatoms are photosynthetic unicellular microalgae that drive global ecological phenomena in the biosphere and are emerging as sustainable feedstock for an increasing number of industrial applications. Diatoms exhibit enormous taxonomic and genetic diversity, which often results in peculiar biochemical and biological traits. Transposable elements (TEs) represent a substantial portion of diatom genomes and have been hypothesized to exert a relevant role in enriching genetic diversity and making a core contribution to genome evolution. Here, through long-read whole-genome sequencing, we identified a mutator-like element (MULE) in the model diatom Phaeodactylum tricornutum, and we report the direct observation of its mobilization within the course of a single laboratory experiment. Under selective conditions, this TE inactivated the uridine monophosphate synthase (UMPS) gene of P. tricornutum, one of the few endogenous genetic loci currently targeted for selectable auxotrophy for functional genetics and genome-editing applications. We report the observation of a recently mobilized transposon in diatoms with unique features. These include the combined presence of a MULE transposase with zinc-finger SWIM-type domains and a diatom-specific E3 ubiquitin ligase of the zinc-finger UBR type, which are suggestive of a mobilization mechanism. Our findings provide new elements for the understanding of the role of TEs in diatom genome evolution and in the enrichment of intraspecific genetic variability.

Screening the Thermotoga maritima genome for new wide-spectrum nucleoside and nucleotide kinases.

Enzymes from thermophilic organisms are interesting biocatalysts for a wide variety of applications in organic synthesis, biotechnology, and molecular biology. Next to an increased stability at elevated temperatures, they were described to show a wider substrate spectrum than their mesophilic counterparts. To identify thermostable biocatalysts for the synthesis of nucleotide analogs, we performed a database search on the carbohydrate and nucleotide metabolism of Thermotoga maritima. After expression and purification of 13 enzyme candidates involved in nucleotide synthesis, these enzymes were screened for their substrate scope. We found that the synthesis of 2'-deoxynucleoside 5'-monophosphates (dNMPs) and uridine 5'-monophosphate from nucleosides was catalyzed by the already known wide-spectrum thymidine kinase and the ribokinase. In contrast, no NMP-forming activity was detected for adenosine-specific kinase, uridine kinase, or nucleotidase. The NMP kinases (NMPKs) and the pyruvate-phosphate-dikinase of T. maritima exhibited a rather specific substrate spectrum for the phosphorylation of NMPs, while pyruvate kinase, acetate kinase, and three of the NMPKs showed a broad substrate scope with (2'-deoxy)nucleoside 5'-diphosphates as substrates. Based on these promising results, TmNMPKs were applied in enzymatic cascade reactions for nucleoside 5'-triphosphate synthesis using four modified pyrimidine nucleosides and four purine NMPs as substrates, and we determined that base- and sugar-modified substrates were accepted. In summary, besides the already reported TmTK, NMPKs of T. maritima were identified to be interesting enzyme candidates for the enzymatic production of modified nucleotides.

Impact of Negative Feedbacks on De Novo Pyrimidines Biosynthesis in Escherichia coli.

Earlier studies aimed at investigating the metabolism of endogenous nucleoside triphosphates in synchronous cultures of E. coli cells revealed an auto-oscillatory mode of functioning of the pyrimidine and purine nucleotide biosynthesis system, which the authors associated with the dynamics of cell division. Theoretically, this system has an intrinsic oscillatory potential, since the dynamics of its functioning are controlled through feedback mechanisms. The question of whether the nucleotide biosynthesis system has its own oscillatory circuit is still open. To address this issue, an integral mathematical model of pyrimidine biosynthesis was developed, taking into account all experimentally verified negative feedback in the regulation of enzymatic reactions, the data of which were obtained under in vitro conditions. Analysis of the dynamic modes of the model functioning has shown that in the pyrimidine biosynthesis system, both the steady-state and oscillatory functioning modes can be realized under certain sets of kinetic parameters that fit in the physiological boundaries of the investigated metabolic system. It has been demonstrated that the occurrence of the oscillatory nature of metabolite synthesis depended on the ratio of two parameters: the Hill coefficient, hUMP1-the nonlinearity of the UMP effect on the activity of carbamoyl-phosphate synthetase, and the parameter r characterizing the contribution of the noncompetitive mechanism of UTP inhibition to the regulation of the enzymatic reaction of UMP phosphorylation. Thus, it has been theoretically shown that the E. coli pyrimidine biosynthesis system possesses its own oscillatory circuit whose oscillatory potential depends to a significant degree on the mechanism of regulation of UMP kinase activity.

Effects of uridine and nucleotides on hemostasis parameters.

Several purinergic receptors have been identified on platelets which are involved in hemostatic and thrombotic processes. The aim of the present study was to investigate the effects of uridine and its nucleotides on platelet aggregation and hemostasis in platelet-rich plasma (PRP) and whole blood. The effects of uridine, UMP, UDP, and UTP at different final concentrations (1 to 1000 µM) on platelet aggregation were studied using an aggregometer. In PRP samples, platelet aggregation was induced by ADP, collagen and epinephrine 3 min after addition of uridine, UMP, UDP, UTP and saline (as a control). All thromboelastogram experiments were performed at 1000 µM final concentrations of uridine and its nucleotides in whole blood. UDP and UTP were also tested in thromboelastogram with PRP. Our results showed that UDP, and especially UTP, inhibited ADP- and collagen-induced aggregation in a concentration-dependent manner. In whole blood thromboelastogram experiments, UDP stimulated clot formation while UTP suppressed clot formation. When thromboelastogram experiments were repeated with PRP, UTP's inhibitory effect on platelets was confirmed, while UDP's stimulated clot forming effect disappeared. Collectively, our data showed that UTP inhibited platelet aggregation in a concentration-dependent manner and suppressed clot formation. On the other hand, UDP exhibited distinct effects on whole blood or PRP in thromboelastogram. These data suggest that the difference on effects of UTP and UDP might have arisen from the different receptors that they stimulate and warrant further investigation with regard to their in vivo actions on platelet aggregation and hemostasis.

Circulating uridine dynamically and adaptively regulates food intake in humans.

Feeding behavior must be continuously adjusted to match energy needs. Recent discoveries in murine models identified uridine as a regulator of energy balance. Here, we explore its contribution to the complex control of food intake in humans by administering a single dose of uridine monophosphate (UMP; 0.5 or 1 g) to healthy participants in two placebo-controlled studies designed to assess food behavior (registration: DRKS00014874). We establish that endogenous circulating uridine correlates with hunger and ensuing food consumption. It also dynamically decreases upon caloric ingestion, prompting its potential role in a negative feedback loop regulating energy intake. We further demonstrate that oral UMP administration temporarily increases circulating uridine and-when within the physiological range-enhances hunger and caloric intake proportionally to participants' basal energy needs. Overall, uridine appears as a potential target to tackle dysfunctions of feeding behavior in humans.

Human uridine 5'-monophosphate synthase stores metabolic potential in inactive biomolecular condensates.

Human uridine 5'-monophosphate synthase (HsUMPS) is a bifunctional enzyme that catalyzes the final two steps in de novo pyrimidine biosynthesis. The individual orotate phosphoribosyl transferase and orotidine monophosphate domains have been well characterized, but little is known about the overall structure of the protein and how the organization of domains impacts function. Using a combination of chromatography, electron microscopy, and complementary biophysical methods, we report herein that HsUMPS can be observed in two structurally distinct states, an enzymatically active dimeric form and a nonactive multimeric form. These two states readily interconvert to reach an equilibrium that is sensitive to perturbations of the active site and the presence of substrate. We determined that the smaller molecular weight form of HsUMPS is an S-shaped dimer that can self-assemble into relatively well-ordered globular condensates. Our analysis suggests that the transition between dimer and multimer is driven primarily by oligomerization of the orotate phosphoribosyl transferase domain. While the cellular distribution of HsUMPS is unaffected, quantification by mass spectrometry revealed that de novo pyrimidine biosynthesis is dysregulated when this protein is unable to assemble into inactive condensates. Taken together, our data suggest that HsUMPS self-assembles into biomolecular condensates as a means to store metabolic potential for the regulation of metabolic rates.

Ultra-Mini Percutaneous Nephrolithotomy (UMP) with Strict Lower Irrigation Pressure Control: Correlation with Post Operative Febrile Urinary Tract Infection Rate

Background: Ultra-mini PCNL (UMP) is a device that removes stones by using 7.5 Fr. nephroscope and 11/12 Fr. working sheath. The stone free rate (SFR) does not lag behind the convetional PCNL, but due to the diameter of the small device, UMP has many disadvantages; Irrigation pressure increases easily during surgery and post operative febrile urinary tract infection (UTI) is relative common. The purpose of this study is to present the surgical results of UMP with strict irrigation pressure control using a pressure control irrigator. Methods: 70 consecutive patients who underwent UMP surgery for kidney stones were enrolled retrospectively. All surgeries proceeded with the shoulder rotated supine position. Of these, initial 35 patients underwent surgery using 100 mmHg irrigation power previously and later 35 patients underwent surgery below 40 mmHg irrigation power. Results: The stone size of the UMP 100 mmHg group was 2.52 ± 1.05 and that of the UMP 40 mmHg group was 2.79 ± 1.32 respectively. Operative time was also slightly shorter in the UMP 40 mmHg group, but there was no statistical difference between the two groups. There was no statistical difference in stone free rate, but UMP 100 mmHg group showed 37.1% of post operative febrile urinary tract infection rate and 11.4 % in UMP 40 mmHg group and they are significantly different (p = 0.039). Conclusions: Strict irrigation pressure control below 40 mm during UMP can reduce post operative febrile UTI without affecting SFR (AU)

Non-target metabolomics reveals the changes of small molecular substances in duck breast meat under different preservation time.

Poultry products are an essential animal source of protein for humans. Many factors could destroy the balance of the poultry production chain and cause an overstock of products, which need to be stored in the frozen storage warehouse for a long time. The long-term frozen storage may affect the quality of meat products. In this study, the changes of small molecular substances were revealed in duck meat during long-term storage using non-targeted metabolomics. The results showed that compared with fresh meat, even if the meat is stored under frozen storage conditions, the number of differential metabolites of frozen storage meat continues to increase with the prolongation of storage time, indicating that the meat composition has changed significantly with the storage time increased. With the increase in storage time, the nitrogen-containing small molecular compounds in duck meat increased (carnosine and anserine, aspartic acid, and tyrosine, 1H-indole-3-acetamide, 2-Hydroxyphenethylamine, 2-Naphylamine, allocystathionine, and O-phosphoethanolamine), the nucleotides decomposition process strengthened (IMP and AMP, GMP and UMP), and the content of organic acid increased (5-hydroxy indole acetic acid, 5-hydroxypentanoic acid and phenylacetate, taurine) and carbohydrate (1-O-sinapoyl-beta-d-glucose, 4-O-beta-d-glucopyranosyl-d-mannose, and alpha-d-glucose). These small molecular substances can be used as biomarkers to detect long-term stored duck meat deterioration. KEGG enrichment analysis showed that protein catabolism, nucleotide catabolism, fat decomposition and oxidation, and carbohydrate decomposition were the main metabolic processes of meat deterioration during the long-term storage of duck meat. In addition, Non-target metabolome technology is a powerful tool to reveal the meat deterioration process during long-term storage systematically. This study provided a reference for optimizing domestic poultry meat storage methods and ensuring food safety.

TENT2, TUT4, and TUT7 selectively regulate miRNA sequence and abundance.

TENTs generate miRNA isoforms by 3' tailing. However, little is known about how tailing regulates miRNA function. Here, we generate isogenic HEK293T cell lines in which TENT2, TUT4 and TUT7 are knocked out individually or in combination. Together with rescue experiments, we characterize TENT-specific effects by deep sequencing, Northern blot and in vitro assays. We find that 3' tailing is not random but highly specific. In addition to its known adenylation, TENT2 contributes to guanylation and uridylation on mature miRNAs. TUT4 uridylates most miRNAs whereas TUT7 is dispensable. Removing adenylation has a marginal impact on miRNA levels. By contrast, abolishing uridylation leads to dysregulation of a set of miRNAs. Besides let-7, miR-181b and miR-222 are negatively regulated by TUT4/7 via distinct mechanisms while the miR-888 cluster is upregulated specifically by TUT7. Our results uncover the selective actions of TENTs in generating 3' isomiRs and pave the way to investigate their functions.

Probing Nascent RNA with Metabolic Incorporation of Modified Nucleosides.

The discovery of previously unknown functional roles of RNA in biological systems has led to increased interest in revealing novel RNA molecules as therapeutic targets and the development of tools to better understand the role of RNA in cells. RNA metabolic labeling broadens the scope of studying RNA by incorporating of unnatural nucleobases and nucleosides with bioorthogonal handles that can be utilized for chemical modification of newly synthesized cellular RNA. Such labeling of RNA provides access to applications including measurement of the rates of synthesis and decay of RNA, cellular imaging for RNA localization, and selective enrichment of nascent RNA from the total RNA pool. Several unnatural nucleosides and nucleobases have been shown to be incorporated into RNA by endogenous RNA synthesis machinery of the cells. RNA metabolic labeling can also be performed in a cell-specific manner, where only cells expressing an essential enzyme incorporate the unnatural nucleobase into their RNA. Although several discoveries have been enabled by the current RNA metabolic labeling methods, some key challenges still exist: (i) toxicity of unnatural analogues, (ii) lack of RNA-compatible conjugation chemistries, and (iii) background incorporation of modified analogues in cell-specific RNA metabolic labeling. In this Account, we showcase work done in our laboratory to overcome these challenges faced by RNA metabolic labeling.To begin, we discuss the cellular pathways that have been utilized to perform RNA metabolic labeling and study the interaction between nucleosides and nucleoside kinases. Then we discuss the use of vinyl nucleosides for metabolic labeling and demonstrate the low toxicity of 5-vinyluridine (5-VUrd) compared to other widely used nucleosides. Next, we discuss cell-specific RNA metabolic labeling with unnatural nucleobases, which requires the expression of a specific phosphoribosyl transferase (PRT) enzyme for incorporation of the nucleobase into RNA. In the course of this work, we discovered the enzyme uridine monophosphate synthase (UMPS), which is responsible for nonspecific labeling with modified uracil nucleobases. We were able to overcome this background labeling by discovering a mutant uracil PRT (UPRT) that demonstrates highly specific RNA metabolic labeling with 5-vinyluracil (5-VU). Furthermore, we discuss the optimization of inverse-electron-demand Diels-Alder (IEDDA) reactions for performing chemical modification of vinyl nucleosides to achieve covalent conjugation of RNA without transcript degradation. Finally, we highlight our latest endeavor: the development of mutually orthogonal chemical reactions for selective labeling of 5-VUrd and 2-vinyladenosine (2-VAdo), which allows for potential use of multiple vinyl nucleosides for simultaneous investigation of multiple cellular processes involving RNA. We hope that our methods and discoveries encourage scientists studying biological systems to include RNA metabolic labeling in their toolkit for studying RNA and its role in biological systems.

Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4).

Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).

Effectiveness of nutritional interventions to prevent nonprogressive congenital and perinatal brain injuries: a systematic review and meta-analysis of randomized trials.

CONTEXT: Nutritional interventions for newborns with brain injury are scarce, and there are gaps in the knowledge of their mechanisms of action in preventing the occurrence of cerebral palsy (CP) or the incidence of other developmental disabilities. OBJECTIVE: The objective of this review was to assess the effect of nutritional interventions in preventing nonprogressive congenital or perinatal brain injuries, or in improving outcomes related to neurological development. DATA SOURCES: Randomized trials on any nutritional intervention for pregnant women at risk of preterm delivery, or for children with low birth weight, preterm, or with confirmed or suspected microcephaly, CP, or fetal alcohol syndrome disorders (FASDs) were retrieved from MEDLINE, Embase, Scopus, Web of Science, LILACS, and CENTRAL databases from inception to September 17, 2020. DATA EXTRACTION: Data extraction, risk of bias (Cochrane Risk of Bias tool 2), and quality of evidence (GRADE approach) were assessed by 2 authors. DATA ANALYSIS: Pooled risk ratios (RRs) with 95% confidence intervals were calculated using a random-effects meta-analysis. Seventeen studies were included on intravenous interventions (magnesium sulfate [n = 5], amino acids [n = 4], vitamin A [n = 1], and N-acetylcysteine [n = 1]); enteral interventions (vitamin D [n = 1], prebiotic [n = 1], nutrient-enriched formula [n = 1], and speed of increasing milk feeds [n = 1]); and oral interventions (choline [n = 1] and docosahexaenoic acid, choline, and uridine monophosphate [n = 1]). All studies assessed CP, except 1 on FASDs. Eight studies were judged as having high risk of bias. Five studies (7413 babies) with high-quality evidence demonstrated decreased risk of childhood CP (RR = 0.68, 95% CI: 0.52-0.88) with magnesium sulfate. Interventions with amino acids had no effect on CP prevention or other outcomes. Except for 1 study, no other intervention decreased the risk of CP or FASDs. CONCLUSION: Although different types of nutritional interventions were found, only those with antenatal magnesium sulfate were effective in decreasing CP risk in preterm infants. Well-designed, adequately powered randomized clinical trials are required.